Biology Answers

Selective qualities of an enzyme are collectively recognized as its_______.
1. rate of reaction 2. active site 3. specificity 4. inhibition

While creating a permanent on a student, a hairdresser accidentally spills some ammonium thioglycolate (also known as perm salt) onto the student’s skin. Ammonium thioglycolate reduces disulphide bonds, which are formed by which amino acid?
1. Methionine. 2. Threonine. 3. Cysteine. 4. Serine.

The α-carbon of an amino acid (except for glycine) is chiral because_____.

1. it is bonded to four different chemical groups in a tetrahedral arrangement 2. it has no net charge 3. it contains a carboxylic acid group 4. it is symmetrical

Which of the following methods is typically used to determine the size of a protein?

1. Isoelectric focusing 2. Agarose gel electrophoresis 3. Affinity chromatography 4. Polyacrylamide gel electrophoresis

Ion-exchange chromatography is a method that can be used to purify proteins on the basis of _____.
1. size 2. hydrophobicity 3. charge 4. primary structure

The lone pair of electrons on the oxygen atom of a H2O molecule______.

1. makes water a good solvent for nonpolar molecules 2. gives the oxygen atom a partial positive charge 3. gives water a low dielectric constant 4. allows water to form hydrogen bonds

I would like to know if different lobes of the liver produce different levels of catalase. If so why? Any research or pointers are extremely helpful! Thankyou.

ATGGGCGTTACAGGAATATTGCAGTTACCTCGTGATCGATTCAAGAGGACATCATTCTTT
CTTTGGGTAATTATCCTTTTCCAAAGAACATTTTCCATCCCACTTGGAGTCATCCACAAT
AGCACATTACAGGTTAGTGCAATTGGTGGACAGGATGGAGACAATGGATACCGGCAGGTATTGGAGTTACAGGCGTTATAATTGCAGTTATCGCTTTATTCTGTATATGCAAATTTGTCTTT(TAG)

• Restriction endonuclease sites:
Nde I - 5’-CATATG-3’
Xho I - 5’-CTCGAG-3’


Q1.) According to the primer design rules, what is the sequence of the shortest forward primer that could be used to amplify the glycoprotein-encoding gene for cloning into a pET-vector for expression of a C-terminally hexahistidine-tagged recombinant glycoprotein protein in Escherichia coli?

Please explain it step by step so I can understand better thank you.

What Tm value (to 1 decimal place) would you use for the forward primer when calculating the annealing temperature for the last 25 cycles of PCR? Assume the forward primer sequence is 5’ CAT ATG GGC GTT ACA GGA ATA TTG 3’.

Do show your calculations, provide the answer with units if possible.

Give an account of geological records.