Answer to Question #105640 in Molecular Biology for Kelly

Question #105640
ATGGGCGTTACAGGAATATTGCAGTTACCTCGTGATCGATTCAAGAGGACATCATTCTTT
CTTTGGGTAATTATCCTTTTCCAAAGAACATTTTCCATCCCACTTGGAGTCATCCACAAT
AGCACATTACAGGTTAGTGCAATTGGTGGACAGGATGGAGACAATGGATACCGGCAGGTATTGGAGTTACAGGCGTTATAATTGCAGTTATCGCTTTATTCTGTATATGCAAATTTGTCTTT(TAG)

• Restriction endonuclease sites:
Nde I - 5’-CATATG-3’
Xho I - 5’-CTCGAG-3’


Q1.) According to the primer design rules, what is the sequence of the shortest forward primer that could be used to amplify the glycoprotein-encoding gene for cloning into a pET-vector for expression of a C-terminally hexahistidine-tagged recombinant glycoprotein protein in Escherichia coli?

Please explain it step by step so I can understand better thank you.
1
Expert's answer
2020-03-16T07:41:10-0400
Dear Kelly, your question requires a lot of work, which neither of our experts is ready to perform for free. We advise you to convert it to a fully qualified order and we will try to help you. Please click the link below to proceed: Submit order

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Comments

No comments. Be the first!

Leave a comment

LATEST TUTORIALS
New on Blog