Search & Filtering
Direction: Arrange the sequence of events that occurs in light reaction. Use numbers 1 to 6 on answering.
___ H2O is split and molecular oxygen is released.
___ Energy of energized electrons is used to phosphorylate ADP,forming ATP.
___ The coenzyme NADP+ becomes reduced, forming NADPH.
___ ATP and NADPH are used in the energy-requiring dark reactions.
___ Chlorophyll captures light energy
___ Energized electron is transferred to an acceptor molecule, and is replaced by an electron from H2O
You read it - then XEvil 5.0 works.
Want to post your promo to 12.000.000 (12 MILLIONS!) websites? No problem - with new "XEvil 5.0 + XRumer 19.0.8" software complex!
Blogs, forums, boards, shops, guestbooks, social networks - any engines with any captchas!
XEvil also compatible with any SEO/SMM programms and scripts, and can accept captchas from any source. Just try it! ;)
Regards, MashaKafag1799
P.S. Huge discounts are available (up to 50%!) for a short review about XEvil on any popular forum or platform. Just ask Official support for discount!
http://XEvil.Net/
Ornithine transcarbamoylase deficiency can lead to the accumulation of what?
The following RNA sequence is a pre-mRNA which has just been transcribed and has not undergone processing yet. It contains a start codon, a stop codon and one intron. Identify the location of the intron and write the mature mRNA transcript. Use a codon table to translate the protein encoded by this mRNA. After determining the protein sequence, use the sequence to show an example of each type of mutation listed and how it would affect the protein. 5’UACGGAUGUCGUUCCACGGAACAGUACUUGACGCCAGCCCCUGGUAUAGUCAGUG 3’
: Some vital information about a plasmid you need for cloning was lost to a Bunsen burner mishap. To create a new plasmid map, you digest your plasmid and get the following results. Draw a map of where the sites are on the circular plasmid (indicate position/distance from each other, and the size of the whole plasmid).
SalI : 10 kb
MspI: 10 kb
XbaI: 2.5 kb, 3.5kb and 4 kb
SalI and MspI: 4 kb and 6 kb
SalI and XbaI: 1 kb, 1.5 kb, 3.5 kb, and 4 kb
MspI and XbaI: 1kb, 2.5 kb, 3 kb, and 3.5 kb
Use drawings to describe the process of cloning a fragment of human DNA, listing the steps and any important enzymes, molecules needed, and important features of these molecules involved. Include a description of how you could use a selectable marker to identify if bacteria have a plasmid. What could you include in your plasmid and on your plate to distinguish the bacteria that have recombinant DNA vs bacteria that have empty vector by color?
The following RNA sequence is a pre-mRNA which has just been transcribed and has not undergone processing yet. It contains a start codon, a stop codon and one intron. Identify the location of the intron and write the mature mRNA transcript. Use a codon table to translate the protein encoded by this mRNA. After determining the protein sequence, use the sequence to show an example of each type of mutation listed and how it would affect the protein.
5’UACGGAUGUCGUUCCACGGAACAGUACUUGACGCCAGCCCCUGGUAUAGUCAGUG 3’
missense?
nonsense?
frameshift?
Is it more detrimental to have an extra copy of a large chromosome or an extra copy of a smaller chromosome?
What are the similarities and differences between endocytosis and exocytosis?
Provide a step-by-step diagram showing the β-oxidation of 2-methylhexanoic acid (see figure below). You only need to show the first cycle. Clearly indicate the products that form after the first cycle of β-oxidation.
