In November 2024
Answer to Question #265762 in Genetics for kelly
The following RNA sequence is a pre-mRNA which has just been transcribed and has not undergone processing yet. It contains a start codon, a stop codon and one intron. Identify the location of the intron and write the mature mRNA transcript. Use a codon table to translate the protein encoded by this mRNA. After determining the protein sequence, use the sequence to show an example of each type of mutation listed and how it would affect the protein. 5’UACGGAUGUCGUUCCACGGAACAGUACUUGACGCCAGCCCCUGGUAUAGUCAGUG 3’
The answer to your question is provided in the image:
-
![Help me with my assignment!]()
Who Can Help Me with My Assignment
There are three certainties in this world: Death, Taxes and Homework Assignments. No matter where you study, and no matter…
-
![How to finish assignment]()
How to Finish Assignments When You Can’t
Crunch time is coming, deadlines need to be met, essays need to be submitted, and tests should be studied for.…
-
![Math Exams Study]()
How to Effectively Study for a Math Test
Numbers and figures are an essential part of our world, necessary for almost everything we do every day. As important…
#340153 on Dec 2023
Comments
Leave a comment