Answer to Question #265762 in Genetics for kelly

Question #265762

The following RNA sequence is a pre-mRNA which has just been transcribed and has not undergone processing yet. It contains a start codon, a stop codon and one intron. Identify the location of the intron and write the mature mRNA transcript. Use a codon table to translate the protein encoded by this mRNA. After determining the protein sequence, use the sequence to show an example of each type of mutation listed and how it would affect the protein. 5’UACGGAUGUCGUUCCACGGAACAGUACUUGACGCCAGCCCCUGGUAUAGUCAGUG 3’


1
Expert's answer
2021-11-15T23:49:02-0500

The answer to your question is provided in the image:

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Comments

No comments. Be the first!

Leave a comment