Search & Filtering
Analyse the uses of genetic engineering technologies in industry and medicine
Research the strengths and weaknesses, advantages and disadvantages of genetic technologies (DNA extraction, DNA amplification, gel electrophoresis, and transformation of cells) to speculate, in an informed manner, about specific future uses of generic engineering technologies. Your counterarguments must include discussion of the reliability and validity of the use of the technologies.
In 5 points, Discuss aquatic, terrestrial and arboreal habitats in relation with adaptation and survival of organisms in these habitats
A. Determine whether the following are molecules or ions.
1. fluorine gas (F )
2. lithium fluoride (LiF)
3. glucose (C ) H O
B. Indicate the number of electrons lost or gained in forming theses ions:
1. Gold (III)
2. OH
C. Give the name of each of the following compounds.
1.NO2
2.NaF
3. CaBr2
D. Given the name of the compound, write the molecular formula.
1.carbon monoxide
2.nitrogen trichloride
1. Determine the number of atoms in 1.75 mol Al
2. Calculate the number of formula units in 25.0 mol NaNO3
3. Given 6.25 mol H O2 determine the number of molecules.
DIRECTIONS: A. How many atoms are in each of the following samples?
a atoms Ne
b molecules CH4
1. What is the percent composition of the following compounds?
a Naphtalene (C10 H8)
b Sucrose (C12 H22 O11)
c Alu um sulfate Al2(SO4)3
Discuss aquatic,terrestrial and aborreal habitat in relation with adaptation and survival of organisms with these habitats
Define DNA
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?
one membrane organellle
A scientist wants to clone a molecule bearing UniProtKB accession number P43657. How will he come to
know about the following?
I. Exact genomic location of the molecule under investigation
II. Coding and noncoding segments of the molecule
III. Untranslated regions of the molecule
#340153 on Dec 2023