A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?
"assignmentexpert.com" is professional group of people in Math subjects! They did assignments in very high level of mathematical modelling in the best quality. Thanks a lot
Comments