A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?
Met Cys Arg Asn Ser Arg
Need a fast expert's response?
and get a quick answer at the best price
for any assignment or question with DETAILED EXPLANATIONS!
Comments