Search & Filtering
A scientist sequencing mRNA identifies the following strand:
CUAUGUGUCGUAACAGCCGAUGACCCG
What is the sequence of the amino acid chain this mRNA makes when it is translated?
Each description below could be used to describe either plants or fungi. Select the 8 descriptions that apply to the Plant Kingdom:
a) includes mushrooms
b) cell walls of chitin
c) have chloroplasts and ribosomes
o)have ribosomes but no chloroplasts
d) includes ferns
e) photosynthesis
f) absorptive nutrition
g) includes yeasts
h) includes molds
i) chemoheterotrophs
j) fermentation
k) cell walls of cellulose
l) photoautotrophs
m) includes mosses
n)alternation of generations life cycle
15.The following are the pieces of evidence of evolution that may be used to infer the evolutionary relationship between organisms EXCEPT:
a. Comparative Anatomy
c. Molecular Bonds
b. Fossil record
d. Embryology
16.Identify what evidence of evolution is used: vertebrate animals such as humans, chickens and fish have gill slits and tails during their embryonic stage.
a. Fossil record
c. Molecular Biology
b. Comparative Anatomy
d. Embryology
12. Mapping of DNA allows scientist to compare the genes of organisms from the past and organisms present today, the evidence of evolution used is:
a. Fossil record
c. Analogous structures
b. Molecular Biology
d. Comparative Anatomy
14.How will you use biogeography as an evidence to infer evolutionary relationship?
a. Organisms living closer at each other and sharing the same niche are also closely related to each other.
b. The unique characteristics of the organisms living on a secluded area is indicative of their ancestry and speciation.
c. Biogeography revealed that organisms with similar developmental pattern even if found at different places might once live together before they were separated due to natural events or forces.
d. All of the above
10. How will you differentiate analogous structures from homologous structures as evidence of evolution?
a. Analogous structures indicate common ancestry while homologous structures suggest evolution because of same environmental factors.
b. Analogous structures are structures which indicates that organisms might developed structures with same function as needs arise while homologous structures showed pattern of common descent from different body structures of closely related specie.
c. Both analogous and homologous structures are body structures used by researchers to study the evolutionary development of organisms while vestigial organisms showed different result.
d. B and C
11. What evidence of evolution is portrayed by the unique species on islands which are usually isolated from another mainland?
a. Fossil record
c. Embryology
b. Comparative Anatomy
d. Biogeography
8. This is the study of body structures of organisms to compare and infer evolutionary links. a. Fossil record c. Embryology b. Comparative Anatomy d. Biogeography9. Which among the following best explain the fossil records as an evidence of evolution? a. Recorded events from the past indicates that the Earth was once filled with water. b. Fossils suggest that the Earth is not the same as it is today, for instance there were once a huge massive interconnected land termed as Pangaea. c. Fossils recorded the history of life on Earth and indicates that ancient life forms were different from modern day species. d. Recorded activities of animals from prehistoric times suggest that people came from monkeys.
6. These body structures indicate that organisms descended from a close common ancestor. a. Analogous structures c. Embryonic structures b. Homologous structures d. Vestigial structures7. Fox and polar bears which are distant relatives both developed white colored fur to adapt to the snowy environment where they habituate. These body structures are identified as: a. Analogous structures c. Embryonic structures b. Homologous structures d. Vestigial structures
There are five individuals in population 1 all with genotype BB. There are 50 individuals in population 2 all with genotype bb. These populations (members of the same species) are widely separated geographically and have similar environmental conditions. What is a likely cause of their genetic variation and why?
Speciation is a process in which ones species gives rise to new species. A population of plants or animals that are separated from their species can no longer exchange genetic material with their original
group is known as
what is the genotype of a colorblind man
