Question #199324

A scientist sequencing mRNA identifies the following strand:

CUAUGUGUCGUAACAGCCGAUGACCCG 

What is the sequence of the amino acid chain this mRNA makes when it is translated?


1
Expert's answer
2021-05-27T10:45:38-0400

Met Cys Arg Asn Ser Arg


Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Comments

No comments. Be the first!
LATEST TUTORIALS
APPROVED BY CLIENTS