Biology Answers

Four species of salamanders in the genus Desmognathus form a streamside salamander guild in the mountains of North Carolina. The four species are found at different distances from the stream, as listed in the table. Suggest one or more hypotheses to explain the relationship between the body sizes of these species and the distance each is found from water. What prediction can you make for each hypothesis, and how could you test that prediction?

which leaf is best component/ raw material for our paper soap: kamias, tamarind, suha, sambong or oregano leaves. what are the benefits of each leaf. thank you very much

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAA

Write the nucleotide sequence for T7 promoter

in paramecium the activity of contractile vacuole was found to increase when transferred from one medium to another, hence it can be concluded that the transfer was from which solution

A 10 g (dry weight) mouse is accidentally drowned in a 25 L bottle of non-sterile spring water that initially contains 10 mg/L oxygen. Assume that 70% of the mouse’s dry weight is CH2O. a. Write the relevant reaction for respiration of the mouse with oxygen. b. Does the jug become anaerobic? c. If 2 ppm NO3- and 15 ppm SO42- are in the spring water, how much of each will be left when the jug reaches equilibrium? Write relevant reactions. d. How much of the mouse will be left, assuming no organism capable of fermentation are present?

Rhodobacter lauracita is a newly discovered bacterium and is a manganesebased
photoautotrophy. Light provides the energy necessary to drive the
production of organic carbon. (Be careful, this question set is asking about
assimilation, rather than dissimilation reactions)
a. How much free energy in kJ/mol would be required to form one mole of
glucose (C6H12O6) if reduced manganese (Mn2+) served as the electron donor
for R. lauracita? Assume that Mn2+ is oxidized to the solid MnO2 (activity =
1), pH = 7, and that Mn2+ and glucose are present at 10-4 M. The partial
pressure of carbon dioxide is 10-3.5 atm. Give the answer in kJ per mole of
glucose produced.
E0’ (V)
1/2 MnO2(s) + 2 H+ + e- = 1/2 Mn2+ + H2O +0.58
1/4 CO2(g) + H+ + e- = 1/24 C6H12O6 + 1/4 H2O -0.43
Fe(OH)3(am) + 3 H+ + e- = Fe2+ + 3 H 2O +0.06

A 10 g (dry weight) mouse is accidentally drowned in a 25 L bottle of non-sterile spring water that initially contains 10 mg/L oxygen. Assume that 70% of the mouse’s dry weight is CH2O. a. Write the relevant reaction for respiration of the mouse with oxygen. b. Does the jug become anaerobic? c. If 2 ppm NO3- and 15 ppm SO42- are in the spring water, how much of each will be left when the jug reaches equilibrium? Write relevant reactions. d. How much of the mouse will be left, assuming no organism capable of fermentation are present?

Increasing levels of complexity begin at the _____ and _____, and continue to the pons and medulla oblongata, hypothalamus, thalamus, and midbrain, basal nuclei, and cerebral cortex.

What is the main new piece of information about early tetrapods that contradicts the old “drying pond” hypothesis of the origins of terrestriality?

What features of the elpistostegalian fishes lead us to infer that they were shallow-water forms?