Answer to Question #99301 in Bioinformatics for Mimo

Question #99301
AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAA

Write the nucleotide sequence for T7 promoter
1
Expert's answer
2019-11-25T08:57:07-0500
Dear Mimo, your question requires a lot of work, which neither of our experts is ready to perform for free. We advise you to convert it to a fully qualified order and we will try to help you. Please click the link below to proceed: Submit order

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Comments

No comments. Be the first!

Leave a comment