Biology Answers

2.3) Tabulate the similarities and differences between DNA polymerase and RNA polymerase.

2.3) Tabulate four differences between DNA replication and RNA transcription.

2.3) From this sense strand of DNA:

5’ATGCCGGGGTGATCTACGTAGATTGCAAAAATGA3’ give the complementary antisense DNA strand. Given that GAUCU and UUGCA are introns, give the modified mRNA strand to be transcribed from the sense strand and the protein sequence that will follow.

2.2) Construct a diagram of the Central Dogma of gene expression for eukaryotes. Use the following terms in your diagram.

Protein    Translation      Entry into cytosol

DNA      Transcription    mRNA

RNA      Pre-mRNA      RNA processing

2.2) Why does DNA synthesis only proceed in the 5’ to 3’ direction?

1. Because DNA polymerase can only add nucleotides to the 3´ end of the polynucleotide strand.
2. Because the 3´ end of the polynucleotide molecule is more electronegative that the 5´ end.
3. Because that is the direction in which the two strands of DNA unzip.
4. Because that is the only direction that polymerase can be oriented.
5. Because the chromosomes are always aligned in the 5´ to the 3´ direction in the nucleus.

2.2) Two chains of DNA must run in _________ direction(s) and must be ________ if they are to bond with each other.

1. The same; uncomplementary.
2. Opposite; uncomplementary.
3. Parallel; uncomplementary.
4. Parallel; complementary.
5. Antiparallel; complementary.

2.2) The DNA strand that is replicated continuously is called the...

1. Primary strand.
2. First strand.
3. Leading strand.
4. Alpha strand.
5. Lagging strand.

2.2) In DNA replication, the lagging strand.

1. is synthesised as a series of Okazaki fragments.
2. is synthesised as a complementary copy of the leading strand.
3. pairs with the leading strand by complementary base pairing.
4. is made up entirely of RNA primer.
5. is not synthesized until the synthesis of the leading strand is complete.

2.2) In replication, once the DNA strands have been separated, reformation of the double helix is prevented by:

1. DNA helicases.
2. Single-strand binding proteins.
3. Topoisomerases.
4. DNA polymerase III.
5. DNA ligase.

2.2) An enzyme called a primase is responsible for:

1. Unwinding the DNA double strand to allow DNA polymerase access to the template DNA.
2. Introducing nicks into the DNA double strand in order to prevent the formation of knots.
3. Hydrolyzing ATP to facilitate DNA unwinding.
4. Adding short strands of RNA to the origin of replication forming an RNA primer.
5. Forming a replication fork in the DNA double helix.