2.3) From this sense strand of DNA:
5’ATGCCGGGGTGATCTACGTAGATTGCAAAAATGA3’ give the complementary antisense DNA strand. Given that GAUCU and UUGCA are introns, give the modified mRNA strand to be transcribed from the sense strand and the protein sequence that will follow.
The complementary antisense DNA strand is: we will replace the T with A and C with G. So answer is
TACGGCCCCACTAGATGCATCTAACGTT
mRNA 5'GAAAA3'