Biology Answers

A. Effect of temperature

Prepare 3 test tubes as follows

Test tube no. 1- 5ml 1% cooked starch solution + 1ml saliva. Keep in a water bath at 40°C

Test tube no. 2- 5ml 1% cooked starch solution+ 1ml saliva. Keep in a water bath at 60°C.

Test tube no. 3- 5ml 1% cooked starch solution+ 1ml saliva. Keep in a water bath at 10°C.

At 5 minutes, take a drop of the reaction mixture from test tube no. 1(stir the contents of the test tube before taking a drop) and with iodine solution. Perform the iodine test for a period of 1 hour. Tabulate your results.

How does paternity testing help with identifying linkage to genetic diseases that can have an impact on their long term health.

What is the connection between glucagon and urea cycle?

GCGGCGGATTGCTAGGCCAATCGTCATTGCTGACTATAATAAAAGCTTAAGCCCTTTCCGCT

GTCGCCTTCACTTGCCGTATGCGATGTTTCCTTCAGCTCCAGGTACAGGTAAGTAGTTAATGCAG

CCCCAGTTTCAGTTGCGGGTCCTTCAGCTCCATTTCCTTTTTAGCCGTACATATGGCAATAAAGCTAAGCT

AGGCTATCGTTCAGTACCGATTCGTGGTGTGCGGG

what are the  cis elements here?

Suppose that there is a mutation in a single-celled organism where the Krebs cycle (TCA/Citric Acid Cycle) doesn't happen. What would be the consequences for that organism? How would their metabolism be similar to ours? How would it be different?

Evolution is often portrayed as producing greater complexity and increased size. Can you think of an example where evolution resulted in reduced complexity or smaller size?

This is a genetics’ question relating to biology and we are required to create a pedigree for the question.

Here is the link to the question, please upload a clear and accessible image of solutions: https://drive.google.com/file/d/1W_k5DidC42fR48D-UQEzkU2xK-UVNsJS/view?usp=drivesdk

investigation to find out if a pheromone trap would help to control the 

leaf miner. 

In a pea plant that breeds true for tall, what possible gametes can be produced? Use the symbol D for tall, d for dwarf.

Should GMO (genetically modified) foods be labelled so that consumers know that they are buying them?