Search & Filtering
Visceral clefts are present in the human embryo in between four to six weeks of early development. What happens to them during later development?
They form jaws
They form laryngeal cartilages
They form gill clefts
They form jaws and laryngeal cartilages
They dissaper during later embryonic development
The genes for Tyrosinemia and Marfan syndrome are divided into 4 map units on
chromosome 15. In a couple, the male is heterozygous for these genes inherited from different
parents. The woman is the carrier of the tyrosinemia gene. Tyrosinemia is transmitted in an
autosomal recessive manner, and Marfan syndrome is transmitted in an autosomal dominant
manner. What are the chances of having a healthy child in the family?
The recessive genes for hemophilia A and agamoglobulinemia are 6.4 map units apart
on the X chromosome. What is the probability of having a child with both anomalies in a family
where the father has hemophilia and the mother carries both recessive genes passed on from her
mother?
how and when is concentrated urine is formed in human body
1. Search for plant omega-3 desaturase (delta-15 desaturase) gene from GenBank and retrieves at least three (3) omega-3 desaturase gene sequences from different plant species or microalgae that share high homology.
a) Perform multiple alignments on the sequences using Clustal Omega [3 M]. Provide your analysis materials (multiple alignment) as in appendix for proof [3 M].
Mitosis and meiosis are similar processes, but they have some very important differences. Explain how mitosis and meiosis are alike and how they are different. Provide at least two similarities and three differences.
1. What kind of mouse model will you use in these studies? Briefly explain.
a. You want to study the innate immune response against a pathogen.
b. You want to study the adaptive immune response against a pathogen
What would happen to an organism that lacked the enzyme that catalyzes the first step in glycolysis?
(b) For the given DNA coding sequence, generate an RNA sequence.
DNA Sequence: CGATGCCTCGCTAGAGGCTCGAAAGCTCTTTCGGAGATAATCG
RNA Sequence:
String Parenthesis Representation:
Arch Diagram:
What is biotic interaction among plants?
