Search & Filtering
Loose connective tissue
Loose connective tissue
What is the importance of immunization in Inactivated Polio Vaccine?
Write a note on AIDS. answer in detail. 10 marks
Which hepatitis is the most contagious? Is hepatitis C contagious after cure? answer in detail. 10 marks
Can humans get leishmaniasis from dogs. Answer in detail. 10 marks
The frequent words with mismatches problem
One way to solve the Frequent Words with Mismatches problem is to generate all 4k k-mers Pattern, compute ApproximatePatternCount(Text, Pattern, d) for each k-mer Pattern, and then find k-mers with the maximum number of approximate occurrences. This is an inefficient approach in practice, since many of the 4k k-mers should not be considered because neither they nor their mutated versions (with up to d mismatches) appear in Text.
Genome= GCAAAATGGAGCAGGATCAGCAAAATGGAAAATAAATGGAGGATCAAAATAAATGGAGGAGGAAAATGGAGGAAAATAAATGGATCAGGAAAATGCAGCAGGATCATCATCAGGAGCAGGATCAAAATTCAGGAGCAGGAGGATCAGCATCAGGAGGATCAGCAGGAAAATGCAGGAGGAGGAGGAAAATTCAAAATGGAGGAGGAGGAGCATCAGCAGCATCAGGAGGAGGATCAGCAGCAGGAGGAGGAGGAGGAAAATGGAGGAGGAGCAGGAGGAGCATCAGGAGGATCAGGAGCATCAGCAAAATTCAAAATGGAGGAAAATGCAGGAAAATGGAGCAGGAAAATAAATTCATCAAAATGCAGGAGGA
k= 6
d= 2
Discuss the steps on how to produce corn plants that can grow in hot dry conditions (drought resistant) using genetic engineering. These keywords should be included in your answer: trait, gene isolation, cloning vector, restriction enzymes, and DNA recombinant.
