Biology Answers

1.    Compare between the structure of the ribosomes in prokaryotic and eukaryotic cells? (1 point):  

2. Explain how exo-enzymes produced by bacteria which digest different macro-molecules in the surrounding environment, won’t digest these molecules inside the bacterial cells? (1 point):  

3. In the peptidoglycan layer of bacterial cells: give a reason why the tetrapeptide side chain is only binding to the NAM molecule and not to the NAG?

4.   Two types of prokaryotic cells can be distinguished: bacteria and archaea. How do these cells differ from each other? Compare their cell wall structure, patterns of cytoplasmic membranes and ribosomal entities and 16S-rRNA? (1.5 points): 

5.Compare between the structure of cell wall in prokaryotic and eukaryotic cells?

When the citric acid cycle was first proposed by Krebs, the “problem” was not that a chiral molecule was produced from a non-chiral molecule—this is easily understood. The difficulty was in understanding why formation of the double bond of cis-aconitate, and subsequent addition of water to form isocitrate, occurred only in the moiety contributed originally by oxaloacetate and not in the group derived from acetyl CoA. When isotopically labeled acetate was added to cells the 14 C-labeled carbon atoms appeared in citrate. Since citrate is a symmetric molecule, the labeled carbon atoms were expected to show up equally in the two versions of isocitrate  by arrows 1 and 2. Instead, only the left-hand form was produced.  This mystery was later solved and find out the reason why only form form is produced?

In three separate experiments of Krebs cycle, pyruvate labeled with 14 C at C-1, at C-2, or at C-3 is metabolized via the pyruvate dehydrogenase complex and the citric acid cycle. 

a.Which labeled pyruvate molecule is the first to yield 14 CO2 ? 

b.Which is the last to yield 14 CO2 ?

c.How many turns of the cycle are required to release all of the labeled carbon atoms as 14 CO2 ?

You prepared a cell-free extract from a pigeon muscle. When glucose is added to the extract and incubated in an atmosphere free of oxygen, the extract efficiently converts glucose to lactate. You decide to use this extract to study the mechanism of action of a novel chemical, that you have synthesized known to inhibit glycolysis. When you add glucose and the chemical to the extract in oxygen free atmosphere you find that fructose 1-6 bisphosphate, DHAP AND GAP all accumulate. However 1,3BPG, PEP and pyruvate are present in relatively low levels. Based on the evidence so far, identify the enzyme that is inhibited by your chemical.

The malate synthase reaction, which produces malate from acetyl-coA and

glyoxylate in the glyoxylate pathway involves chemistry similar to citrate synthase

reaction. Find out the similarities between these two.

A pure - breeding black pig is crossed with a pure - breeding white prg & work out the genoty pic & Phenoty psc raciso of fland fy of spring, if gene for block coat as domination

A. Effect of temperature

Prepare 3 test tubes as follows

Test tube no. 1- 5ml 1% cooked starch solution + 1ml saliva. Keep in a water bath at 40°C

Test tube no. 2- 5ml 1% cooked starch solution+ 1ml saliva. Keep in a water bath at 60°C.

Test tube no. 3- 5ml 1% cooked starch solution+ 1ml saliva. Keep in a water bath at 10°C.

At 5 minutes, take a drop of the reaction mixture from test tube no. 1(stir the contents of the test tube before taking a drop) and with iodine solution. Perform the iodine test for a period of 1 hour. Tabulate your results.

How does paternity testing help with identifying linkage to genetic diseases that can have an impact on their long term health.

What is the connection between glucagon and urea cycle?

GCGGCGGATTGCTAGGCCAATCGTCATTGCTGACTATAATAAAAGCTTAAGCCCTTTCCGCT

GTCGCCTTCACTTGCCGTATGCGATGTTTCCTTCAGCTCCAGGTACAGGTAAGTAGTTAATGCAG

CCCCAGTTTCAGTTGCGGGTCCTTCAGCTCCATTTCCTTTTTAGCCGTACATATGGCAATAAAGCTAAGCT

AGGCTATCGTTCAGTACCGATTCGTGGTGTGCGGG

what are the  cis elements here?