Molecular Biology Answers

ATGGGCGTTACAGGAATATTGCAGTTACCTCGTGATCGATTCAAGAGGACATCATTCTTT
CTTTGGGTAATTATCCTTTTCCAAAGAACATTTTCCATCCCACTTGGAGTCATCCACAAT
AGCACATTACAGGTTAGTGCAATTGGTGGACAGGATGGAGACAATGGATACCGGCAGGTATTGGAGTTACAGGCGTTATAATTGCAGTTATCGCTTTATTCTGTATATGCAAATTTGTCTTT(TAG)

• Restriction endonuclease sites:
Nde I - 5’-CATATG-3’
Xho I - 5’-CTCGAG-3’


Q1.) According to the primer design rules, what is the sequence of the shortest forward primer that could be used to amplify the glycoprotein-encoding gene for cloning into a pET-vector for expression of a C-terminally hexahistidine-tagged recombinant glycoprotein protein in Escherichia coli?

Please explain it step by step so I can understand better thank you.

What Tm value (to 1 decimal place) would you use for the forward primer when calculating the annealing temperature for the last 25 cycles of PCR? Assume the forward primer sequence is 5’ CAT ATG GGC GTT ACA GGA ATA TTG 3’.

Do show your calculations, provide the answer with units if possible.

Which of the following is true of the lac operon in E. coli?
1. The operon is only switched on in the absence of lactose in the growth medium.
2. The lac operon messenger RNA is a polycistronic mRNA (it carries information for
synthesis of several proteins)
3. The enzyme β-galactosidase is only produced in large quantities when the lac
repressor is bound to the operator.
4. The promoter is the binding site for the lac repressor.

The following are associated with cloning, except________.
1. restriction endonucleases
2. vectors
3. FACS
4. transfection
5. PCR

You are working in a molecular biology lab and, unknown to you, your lab partner left
the foreign genomic DNA that you are planning to clone on the lab bench overnight
instead of storing it in the freezer. As a result, it was degraded by nucleases, but still
used in the experiment. The plasmid, on the other hand, is fine. What results would
you expect from your molecular cloning experiment?
1. There will be no colonies on the bacterial plate.
2. There will be blue colonies only.
3. There will be blue and white colonies.
4. The will be white colonies only.

If glucose is absent, but so is lactose, the lac operon will be ________.
1. activated
2. repressed
3. activated, but only partially
4. mutated

Which statement about nucleic acids is not correct?
1. They are macromolecules.
2. They are organic molecules.
3. They are typically long, linear molecules.
4. None; all of these statements are correct

The binding of ________ is required for transcription to start.
1. a protein
2. DNA polymerase
3. RNA polymerase
4. a transcription factor

Post-translational control refers to the:
1. Regulation of gene expression after transcription
2. Regulation of gene expression after translation
3. Control of epigenetic activation
4. Period between transcription and translation

n which of the following situations would cells die by necrosis, not apoptosis?
1. Removal of cells with damaged DNA that cannot be repaired.
2. Removal of developing neurones that fail to make profitable connections with
other cells.
3. Removal of heart muscle cells damaged by oxygen depletion following cardiac
infarction.
4. Removal of virus infected cells.