Genetics Answers

Questions: 1 067

Answers by our Experts: 1 067

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Search & Filtering

The following RNA sequence is a pre-mRNA which has just been transcribed and has not undergone processing yet. It contains a start codon, a stop codon and one intron. Identify the location of the intron and write the mature mRNA transcript. Use a codon table to translate the protein encoded by this mRNA. After determining the protein sequence, use the sequence to show an example of each type of mutation listed and how it would affect the protein. 5’UACGGAUGUCGUUCCACGGAACAGUACUUGACGCCAGCCCCUGGUAUAGUCAGUG 3’


: Some vital information about a plasmid you need for cloning was lost to a Bunsen burner mishap. To create a new plasmid map, you digest your plasmid and get the following results. Draw a map of where the sites are on the circular plasmid (indicate position/distance from each other, and the size of the whole plasmid).

SalI : 10 kb

MspI: 10 kb

XbaI: 2.5 kb, 3.5kb and 4 kb

SalI and MspI: 4 kb and 6 kb

SalI and XbaI: 1 kb, 1.5 kb, 3.5 kb, and 4 kb

MspI and XbaI: 1kb, 2.5 kb, 3 kb, and 3.5 kb


Use drawings to describe the process of cloning a fragment of human DNA, listing the steps and any important enzymes, molecules needed, and important features of these molecules involved. Include a description of how you could use a selectable marker to identify if bacteria have a plasmid. What could you include in your plasmid and on your plate to distinguish the bacteria that have recombinant DNA vs bacteria that have empty vector by color?


The following RNA sequence is a pre-mRNA which has just been transcribed and has not undergone processing yet. It contains a start codon, a stop codon and one intron. Identify the location of the intron and write the mature mRNA transcript. Use a codon table to translate the protein encoded by this mRNA. After determining the protein sequence, use the sequence to show an example of each type of mutation listed and how it would affect the protein.

5’UACGGAUGUCGUUCCACGGAACAGUACUUGACGCCAGCCCCUGGUAUAGUCAGUG 3’


missense?

nonsense?

frameshift?


The shape and the colour of radishes are controlled by two independent pairs of alleles that show no dominance; each genotype is distinguishable phenotypically. The colour may be yellow (YY), purple (Y′ Y), or white (Y′ Y′) and the shape may be long (LL), oval (L′ L), or round (L′ L′). using the Punnett square method, diagram a cross between yellow, long (YYLL) and white, round (Y′ Y′ L′ L′) radishes and summarize the F2 results under the headings phenotypes, genotypes, genotypic frequency, and phenotype ratio.


albinismis a hereditary autosomal recessive pathology . an albino woman married a healthy man and gave birth toalbino child . what is the probability in % that the second child wi also be albino


Genetically dominant characters are controlled by


In tomato,a plant with smooth,red fruits was crossed with another plant having wrinkled green fruits.The F1 generation yielded plants all of which produced smooth red fruits.What are the phenotypes of F2 and in what proportion?using punnet diagram show how you arrived at your answer.


What is missing in our understanding of plant or animal genetics, to create a new organism artificially? I understand the phases of development, but don’t understand why we cannot take the chemicals of a seedling or embryo and create them artificially? What is still missing? And if we could create artificial life, wouldn’t it solve many of the problems of infertility and botanical flourishing?


■Assess what happens in the following error mutations and show how this affects the proteins produced

Missense, nonsense, silent, insertion, deletion, duplication, frameshift

Include examples to demonstrate points

LATEST TUTORIALS
APPROVED BY CLIENTS