Genetics Answers

Gene flow between two distantly-located populations will cause the traits & genes of individuals in the two populations to ___________ over time.  

In a pea plant that breeds true for tall, what possible gametes will be produced

GENE F

DNA:      TAG  TAG  TCT

mRNA:

tRNA:  

AMINO ACID SEQUENCE:

TRAIT:

GENE G

DNA:     CCA  TCC  TTT  GGG

mRNA:

tRNA:  

AMINO ACID SEQUENCE:

TRAIT:

GENE H

DNA:     CCA  CAT  AAT

mRNA:

tRNA:  

AMINO ACID SEQUENCE:

TRAIT:

why when studying meiosis would it be easiest or best to study male gametogenesis rather than female?

Calculate if your data differ significantly from the null hypothesis that neither individual is favoured, i.e. counts should be close to 50:50.

• Use χ2 tests; degrees of freedom are the (number of classes – 1) = 1. The critical values for 2 χ1 = 3.841459 for P = 0.05, 2 χ1 = 6.634897 for P = 0.01, and 2 χ1 = 10.82757 for P = 0.001. Remember to use counts, not percentages in the test.

• For multiple tests (say n) one should adjust the p-value where you are happy to reject the null hypothesis to (p-vale)/n.

• Remember that χ2 is the sum of at least two values.

• In each case state your P-value and exactly what the P-value you obtain means in terms of the null hypothesis. If the probability is smaller than 0.05 and also smaller than 0.01, then we say p < 0.01 as this indicates a stronger rejection of the null hypothesis.

When expressed, a new allele causes its carrier to give a recipient 0.4 units of benefit at a cost of 0.3 units. Calculate if this allele will increase in frequency if:

a) It is autosomal and both parents are recipients (unless stated otherwise, you can assume it is not imprinted).

b) It is in a haplodiploid species, the actor is a female and the recipient is her brother.

c) It is on the mitochondrial genome, expressed in males and sisters are recipients.

Calculate the relatedness of a boy-child to a) his biological mother, b) stepfather, and c) full sister for i) a regular autosomal locus, and ii) for if he was a haplodiploid. Drawing the mother etc.’s genotypes and the gametes, indicate identity and non-identity with different colour lines, count ibd fractions and take a ratio to obtain the relatedness. Where the kin-value is important, calculate that too (20)

A group of researchers studying turtles have isolated an autosomal mutation that confers ninja-like –reflexes just prior to adulthood. This mutation is recessive to the normal slow allele (S). when homozygous slow turtle is mated to a homozygous mutant ninja turtle and the F1 are interbred, the following phenotypes are observed among the F2 young adult: 25 slow, 15 ninjas. Answer the following:

1.      What are the phenotype of the parental generation?

2.      What are the phenotype of the F1 generation?

3.      Perform the Chi-square analysis.

The following RNA sequence is a pre-mRNA which has just been transcribed and has not undergone processing yet. It contains a start codon, a stop codon and one intron. Identify the location of the intron and write the mature mRNA transcript. Use a codon table to translate the protein encoded by this mRNA. After determining the protein sequence, use the sequence to show an example of each type of mutation listed and how it would affect the protein. 5’UACGGAUGUCGUUCCACGGAACAGUACUUGACGCCAGCCCCUGGUAUAGUCAGUG 3’

: Some vital information about a plasmid you need for cloning was lost to a Bunsen burner mishap. To create a new plasmid map, you digest your plasmid and get the following results. Draw a map of where the sites are on the circular plasmid (indicate position/distance from each other, and the size of the whole plasmid).

SalI : 10 kb

MspI: 10 kb

XbaI: 2.5 kb, 3.5kb and 4 kb

SalI and MspI: 4 kb and 6 kb

SalI and XbaI: 1 kb, 1.5 kb, 3.5 kb, and 4 kb

MspI and XbaI: 1kb, 2.5 kb, 3 kb, and 3.5 kb