1. A DNA fragment encoding a polypeptide has a following order of nitrogenous bases:
AAAACCAAAATACTTATACAA. During replication, the third adenine on the left was cut from the
chain. Determine the structure of the polypeptide chain encoded by this DNA region according to normal
and mutated condition. Identify the type of gene mutation.
TTTGGTTTTATGAATATGTT
Deletion gene mutation.