Learn more about our help with Assignments: Python
Search & Filtering
Python
An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG"...just use that in the answer)
Given: A DNA string s of length at most 1000 nt.
Write python code to return four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.
Given: A DNA string s of length at most 1000 nt.
Write python code to return four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.
Python
For this lab you will find the area of an irregularly shaped room with the shape as shown above.
Ask the user to enter the values for sides A, B, C, D, and E and print out the total room area.
Remember the formula for finding the area of a rectangle is length * width and the area of a right triangle is 0.5 * the base * height.
Please note the final area should be in decimal format.
Sample Run
Enter side A: 11
Enter side B: 2
Enter side C: 4
Enter side D: 7
Enter side E: 1
Output
Room Area: 53.5
Ask the user to enter the values for sides A, B, C, D, and E and print out the total room area.
Remember the formula for finding the area of a rectangle is length * width and the area of a right triangle is 0.5 * the base * height.
Please note the final area should be in decimal format.
Sample Run
Enter side A: 11
Enter side B: 2
Enter side C: 4
Enter side D: 7
Enter side E: 1
Output
Room Area: 53.5
Python
This is api documentation- http://api.citybik.es/v2/
i need to create programme where user will choose country by input and if there is this city -> http://api.citybik.es/v2/networks i want to create object for city and save its infoin it. like city name, longitude, latitude and companies . after that my programme should print name of companies which are in the city that she/ he have choosen
i need to create programme where user will choose country by input and if there is this city -> http://api.citybik.es/v2/networks i want to create object for city and save its infoin it. like city name, longitude, latitude and companies . after that my programme should print name of companies which are in the city that she/ he have choosen
Python
A positive integer m is a sum of squares if it can be written as k + x where k > 0, x > 0 and both k and x are perfect squares. Write a Python function sumofsquares(m) that takes an integer m returns True if m is a sum of squares and False otherwise. Here are some examples to show how your function should work.
>>> sumofsquares(41) should return True
>>> sumofsquares(30) should return False
>>> sumofsquares(17) should return True
>>> sumofsquares(41) should return True
>>> sumofsquares(30) should return False
>>> sumofsquares(17) should return True
Python
In this program, you will create a personal organizer. Using parallel arrays you will store the following information on each event in your organizer:
Month (1 - 12)
Day (1 - 31)
Year
Event name
If the user enters an incorrect month the month should be set to January.
If the user enters an incorrect day then the day should be set to 1.
Write the following methods:
Add an event
Print all events
Print events in a specific month
Your program should follow how the sample run (below) asks for input and how it outputs events.
It should first keep asking for new events to add until the user says NO. Then, it should print all the events entered. Finally, it should ask the user for a specific month that he or she would like to see events from*
Month (1 - 12)
Day (1 - 31)
Year
Event name
If the user enters an incorrect month the month should be set to January.
If the user enters an incorrect day then the day should be set to 1.
Write the following methods:
Add an event
Print all events
Print events in a specific month
Your program should follow how the sample run (below) asks for input and how it outputs events.
It should first keep asking for new events to add until the user says NO. Then, it should print all the events entered. Finally, it should ask the user for a specific month that he or she would like to see events from*
Python
In this program, you will create a personal organizer. Using parallel arrays you will store the following information on each event in your organizer:
Month (1 - 12)
Day (1 - 31)
Year
Event name
If the user enters an incorrect month the month should be set to January.
If the user enters an incorrect day then the day should be set to 1.
Write the following methods:
Add an event
Print all events
Print events in a specific month
Your program should follow how the sample run (below) asks for input and how it outputs events.
It should first keep asking for new events to add until the user says NO. Then, it should print all the events entered. Finally, it should ask the user for a specific month that he or she would like to see events from.
Month (1 - 12)
Day (1 - 31)
Year
Event name
If the user enters an incorrect month the month should be set to January.
If the user enters an incorrect day then the day should be set to 1.
Write the following methods:
Add an event
Print all events
Print events in a specific month
Your program should follow how the sample run (below) asks for input and how it outputs events.
It should first keep asking for new events to add until the user says NO. Then, it should print all the events entered. Finally, it should ask the user for a specific month that he or she would like to see events from.
Python
Write a free function getStat the gets a queue of integers, and calculates the highest and lowest numbers in the queue, as well as the sum of all of the integers in the queue. You may manipulate the original queue any way but upon completion of the function, the original queue must be restored to its original configuration. Use the queue operations defined in the queue class. Write a main function to test the code and please leave comments.
Sample output:
the original queue: 4 10 5 1 3 2 5 1 3 7
highest=10
lowest=1
sum is 41
the queue after calculations: 4 10 5 1 3 2 5 1 3 7
Sample output:
the original queue: 4 10 5 1 3 2 5 1 3 7
highest=10
lowest=1
sum is 41
the queue after calculations: 4 10 5 1 3 2 5 1 3 7
Python
Declare a 4x5 array called N. Write a subprogram called printIt to print the values in N. Use this subprogram to print the values in the array after each part of the initialization exercise.
Write the loops to initialize the array to the following:
Write the loops to initialize the array to the following:
Python
Implement a sorting algorithm and sort the following array of words alphabetically. For this question, do not define or use an explicit swap function (you will revisit this in question 3). Can not use the sort function either
vocab = [ "Libraries", "Bandwidth", "Hierarchy", "Software", "Firewall", "Cybersecurity","Phishing", "Logic", "Productivity"]
vocab = [ "Libraries", "Bandwidth", "Hierarchy", "Software", "Firewall", "Cybersecurity","Phishing", "Logic", "Productivity"]
Python
how to: In this program, you will create a personal organizer. Using parallel arrays you will store the following information on each event in your organizer:
Month (1 - 12)
Day (1 - 31)
Year
Event name
If the user enters an incorrect month the month should be set to January.
If the user enters an incorrect day then the day should be set to 1.
Write the following methods:
Add an event
Print all events
Print events in a specific month
Your program should follow how the sample run (below) asks for input and how it outputs events.
It should first keep asking for new events to add until the user says NO. Then, it should print all the events entered. Finally, it should ask the user for a specific month that he or she would like to see events from.
Month (1 - 12)
Day (1 - 31)
Year
Event name
If the user enters an incorrect month the month should be set to January.
If the user enters an incorrect day then the day should be set to 1.
Write the following methods:
Add an event
Print all events
Print events in a specific month
Your program should follow how the sample run (below) asks for input and how it outputs events.
It should first keep asking for new events to add until the user says NO. Then, it should print all the events entered. Finally, it should ask the user for a specific month that he or she would like to see events from.
