Answer to Question #91175 in Python for Promise Omiponle

Question #91175
An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG"...just use that in the answer)

Given: A DNA string s of length at most 1000 nt.

Write python code to return four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.
1
Expert's answer
2019-06-26T11:54:42-0400
Dear Promise Omiponle, your question requires a lot of work, which neither of our experts is ready to perform for free. We advise you to convert it to a fully qualified order and we will try to help you. Please click the link below to proceed: Submit order

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Comments

No comments. Be the first!

Leave a comment