Answer to Question #91175 in Python for Promise Omiponle

Question

An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG"...just use that in the answer)

Given: A DNA string s of length at most 1000 nt.

Write python code to return four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.

Answer 1

Dear Promise Omiponle, your question requires a lot of work, which neither of our experts is ready to perform for free. We advise you to convert it to a fully qualified order and we will try to help you. Please click the link below to proceed: Submit order