Biology Answers

Use drawings to describe the process of cloning a fragment of human DNA, listing the steps and any important enzymes, molecules needed, and important features of these molecules involved. Include a description of how you could use a selectable marker to identify if bacteria have a plasmid. What could you include in your plasmid and on your plate to distinguish the bacteria that have recombinant DNA vs bacteria that have empty vector by color?

The following RNA sequence is a pre-mRNA which has just been transcribed and has not undergone processing yet. It contains a start codon, a stop codon and one intron. Identify the location of the intron and write the mature mRNA transcript. Use a codon table to translate the protein encoded by this mRNA. After determining the protein sequence, use the sequence to show an example of each type of mutation listed and how it would affect the protein.

5’UACGGAUGUCGUUCCACGGAACAGUACUUGACGCCAGCCCCUGGUAUAGUCAGUG 3’

missense?

nonsense?

frameshift?

Is it more detrimental to have an extra copy of a large chromosome or an extra copy of a smaller chromosome?

What are the similarities and differences between endocytosis and exocytosis?

Provide a step-by-step diagram showing the β-oxidation of 2-methylhexanoic acid (see figure below). You only need to show the first cycle. Clearly indicate the products that form after the first cycle of β-oxidation.

What do you think will happen to living things if all enzymes will be deactivated for 24 hours?

Answer the blank: A certain protein can only act as a catalyst if it is linked with the B vitamin biotin. This protein is called _______________________ and biotin is its ______________________.

Answer the blank: In order for the enzyme lactase to catalyze the digestion of lactose into the monosaccharides glucose and galactose, lactose must first bind to the _____________________ of the enzyme.

Answer the blank: Based on where they perform their functions, the enzymes amylase and maltase in human saliva are classified as ________________________________.

Answer the blank: Many of the enzymes involved in photosynthesis aid in chemical reactions that remove electrons from the oxygen atoms in water and transfer these electrons to the carbon atoms in carbon dioxide. Based on the kind of reaction that they catalyze, these enzymes are classified as ______________________________.