Biology Answers

Other 1723
Biochemistry 1273
Cell Biology 1172
Genetics 1067
Microbiology 644
Human Anatomy and Physiology 624
Molecular Biology 512
Zoology 407
Evolution 305
Ecology 261
Bioinformatics 107
Biomechanics 8
Plant biology 4
Immunology 2

Questions answered by Experts: 8 109

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Search

A man is trapped in an air-conditioned room for 12 hours without food. Explain the physiological processes which occur.

THE MAD RUSH DOWNSTAIRS: FREE ENERGY AS THE DRIVING FORCE BEHIND CHEMICAL REACTIONS

Write out and explain the intuitive meaning of the equation for the free energy change in a chemical reaction,
and draw an accompanying color-coded and labeled graph of the equation. Talk about what drives chemical reactions
inside living cells. Be sure to carefully define all the terms in the equation, and give intuitive explanations of how changing the independent variables in the equation change the "delta G" value and thereby determine whether the
reaction goes forward, backward, or is at equilibrium. Use the hydrolysis of nucleotides in the formation of RNA
and DNA to illustrate the thermodynamic principles that allow cells to run the chemical reactions that sustain life.
At the very end, address the question of whether the chemical reactions occurring inside a living cell are at equilibrium,
or away from equilibrium, and why that has to be the case for life to go on.

Which promoter initiates which life cycle (lysogenic & Lytic)? Mention both types of promoters and their characteristics.


A group of researchers studying turtles have isolated an autosomal mutation that confers ninja-like –reflexes just prior to adulthood. This mutation is recessive to the normal slow allele (S). when homozygous slow turtle is mated to a homozygous mutant ninja turtle and the F1 are interbred, the following phenotypes are observed among the F2 young adult: 25 slow, 15 ninjas. Answer the following:

1.      What are the phenotype of the parental generation?

2.      What are the phenotype of the F1 generation?

3.      Perform the Chi-square analysis.


Hi, I wanted to enquire about the effectiveness and aggressiveness of ablation for Atrial fibrillation


What are the advantages and disadvantage of molecular oxygen having high


affinity for electrons?

You read it - then XEvil 5.0 works.



Want to post your promo to 12.000.000 (12 MILLIONS!) websites? No problem - with new "XEvil 5.0 + XRumer 19.0.8" software complex!


Blogs, forums, boards, shops, guestbooks, social networks - any engines with any captchas!


XEvil also compatible with any SEO/SMM programms and scripts, and can accept captchas from any source. Just try it! ;)



Regards, MashaKafag1799



P.S. Huge discounts are available (up to 50%!) for a short review about XEvil on any popular forum or platform. Just ask Official support for discount!



http://XEvil.Net/

Ornithine transcarbamoylase deficiency can lead to the accumulation of what?

The following RNA sequence is a pre-mRNA which has just been transcribed and has not undergone processing yet. It contains a start codon, a stop codon and one intron. Identify the location of the intron and write the mature mRNA transcript. Use a codon table to translate the protein encoded by this mRNA. After determining the protein sequence, use the sequence to show an example of each type of mutation listed and how it would affect the protein. 5’UACGGAUGUCGUUCCACGGAACAGUACUUGACGCCAGCCCCUGGUAUAGUCAGUG 3’


: Some vital information about a plasmid you need for cloning was lost to a Bunsen burner mishap. To create a new plasmid map, you digest your plasmid and get the following results. Draw a map of where the sites are on the circular plasmid (indicate position/distance from each other, and the size of the whole plasmid).

SalI : 10 kb

MspI: 10 kb

XbaI: 2.5 kb, 3.5kb and 4 kb

SalI and MspI: 4 kb and 6 kb

SalI and XbaI: 1 kb, 1.5 kb, 3.5 kb, and 4 kb

MspI and XbaI: 1kb, 2.5 kb, 3 kb, and 3.5 kb


LATEST TUTORIALS
APPROVED BY CLIENTS