Other Programming & Computer Science Answers

1.Write a program using one-dimensional array that accept 5 input values from the keyboard. Then it 

should also accept a number to search. This number is to be searched if it is among the five inputs. If 

it is found, display the message “Searched number is found!”, otherwise display “Search number is not 

included in the list”.

Sample Output:

Enter five values:

5 10 15 20 25

Enter a number to search: 15

Search number is found!

Do a presentation on features of MS Access

a.    If a computer user is processing lots of data, as a young computer scientist/engineer technically explain in details how processing is done from the input device such as keyboard through the activities of the central processing unit and memory. Illustrate these processes and explain how the data outputs onto your output devices such as the screen.

b.   Dereck is trying to download a movie from a torrent site using the utorrents downloader. Since this downloader is not downloading fast enough, he decides to develop his own downloader, which works faster than the current downloader (Utorrents) he is using. Explain the type of software Kofi developed, and compare with examples other types of Application Softwares.

a. The Turing machine was invented in 1936 by Alan Turing, who called it an "a-machine" (automatic machine). Explain how this system operated, compare, and compare it with the modern digital computers.

b.    A company has contracted you to develop an Information System for them considering their business processes. As a software engineer, explain in your own words with examples at each stage, the development processes you will go through to develop this system.

c. The computer System was designed to perform a specific task. Explain with practical examples how the computer performs this task. Support your explanation with a diagram.

difference between client server systems and peer to peer systems      

What is computer virus

Give the expected results of the following "R" commands. ( you need not copy the question in your answer sheet; just write the "R" output).

R command

1. > a = 5;a

2. > x=5

> y=2

> x/y

3 . > x = c ( True, False, 0,6)

>!x

4 . > x = 1:7; x

5. > x = matrix (1:12, 4, 3); x

Q1: DNA fragment

GTACCCGACACTTCCGTCCCCTTC

Derive the shannon-fano code?

Q2:

encode the following token stream using simple repetition sppression and run length encoding

ABC000AAB00000000DEFAB00000

Ahmad is an IT expert in ABC company that makes the biscuits with ISO standard. Ahmad needs to develop a system that take the picture of biscuits to control the overheated situation. The normal picture is not recognizable for overheated surface. So, Ahmad needs to transform the picture for a clear view to control the said situation.

What will you suggest Ahmad from magnification or minification of image texture in the transformation process? Discuss it with solid reason.

1. Compare and contrast among the data formats used in XML, WSDL, SOAP and UDDI.