Biology Answers

4. In organic chemistry and biochemistry labs, diethyl ether (CH₃CH₂OCH₂CH₃) and water (H₂O) are often used to do liquid/liquid extractions. These two liquids form two layers or are immiscible.  

(a) Why are they immiscible, i.e. why do they form two layers?

(b) You are extracting Vitamin Alpha and Vitamin Omega from a new microbe that has been discovered in an underwater steam vent and find that (i) Vitamin Alpha separates into the water fraction, what functional groups would you expect on it? Why? (ii) You find that Vitamin Omega separates into the diethyl ether fraction, what functional groups would you expect to find on it? Why?

Loose connective tissue

Loose connective tissue

What is the importance of immunization in Inactivated Polio Vaccine?

Write a note on AIDS. answer in detail. 10 marks

Which hepatitis is the most contagious? Is hepatitis C contagious after cure? answer in detail. 10 marks

Can humans get leishmaniasis from dogs. Answer in detail. 10 marks

The frequent words with mismatches problem

One way to solve the Frequent Words with Mismatches problem is to generate all 4^k k-mers Pattern, compute ApproximatePatternCount(Text, Pattern, d) for each k-mer Pattern, and then find k-mers with the maximum number of approximate occurrences. This is an inefficient approach in practice, since many of the 4^k k-mers should not be considered because neither they nor their mutated versions (with up to d mismatches) appear in Text.

Genome= GCAAAATGGAGCAGGATCAGCAAAATGGAAAATAAATGGAGGATCAAAATAAATGGAGGAGGAAAATGGAGGAAAATAAATGGATCAGGAAAATGCAGCAGGATCATCATCAGGAGCAGGATCAAAATTCAGGAGCAGGAGGATCAGCATCAGGAGGATCAGCAGGAAAATGCAGGAGGAGGAGGAAAATTCAAAATGGAGGAGGAGGAGCATCAGCAGCATCAGGAGGAGGATCAGCAGCAGGAGGAGGAGGAGGAAAATGGAGGAGGAGCAGGAGGAGCATCAGGAGGATCAGGAGCATCAGCAAAATTCAAAATGGAGGAAAATGCAGGAAAATGGAGCAGGAAAATAAATTCATCAAAATGCAGGAGGA

k= 6

d= 2