Molecular Biology Answers

Questions: 572

Answers by our Experts: 542

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Search & Filtering

A researcher isolates DNA using TBE buffer and use it for cloning experiment. He fails to get the recombinant plasmid, why?


2.3) Which part of a ribosome accepts a tRNA molecule that is attached to a growing polypeptide chain?

  1. A site
  2. P site
  3. E site
  4. all because the growing polypeptide moves from one site to the other.

2.3) What is a polyribosome?


2.3) What are the roles of the P site, A site and E site on the large subunit of the ribosome?


2.3) Discuss the functions of mRNA, rRNA and tRNA during protein synthesis.


2.3) Give short explanations for the following terms: promoter; “upstream” end of a transcription unit; “downstream” end of a transcription unit; Poly A tail.


2.3) Tabulate the similarities and differences between DNA polymerase and RNA polymerase.


2.3) Tabulate four differences between DNA replication and RNA transcription.


2.3) From this sense strand of DNA:

5’ATGCCGGGGTGATCTACGTAGATTGCAAAAATGA3’ give the complementary antisense DNA strand. Given that GAUCU and UUGCA are introns, give the modified mRNA strand to be transcribed from the sense strand and the protein sequence that will follow.


2.2) Construct a diagram of the Central Dogma of gene expression for eukaryotes. Use the following terms in your diagram.


Protein    Translation      Entry into cytosol

DNA      Transcription    mRNA

RNA      Pre-mRNA      RNA processing


LATEST TUTORIALS
APPROVED BY CLIENTS