Molecular Biology Answers

2.3) What is a polyribosome?

2.3) What are the roles of the P site, A site and E site on the large subunit of the ribosome?

2.3) Discuss the functions of mRNA, rRNA and tRNA during protein synthesis.

2.3) Give short explanations for the following terms: promoter; “upstream” end of a transcription unit; “downstream” end of a transcription unit; Poly A tail.

2.3) Tabulate the similarities and differences between DNA polymerase and RNA polymerase.

2.3) Tabulate four differences between DNA replication and RNA transcription.

2.3) From this sense strand of DNA:

5’ATGCCGGGGTGATCTACGTAGATTGCAAAAATGA3’ give the complementary antisense DNA strand. Given that GAUCU and UUGCA are introns, give the modified mRNA strand to be transcribed from the sense strand and the protein sequence that will follow.

2.2) Construct a diagram of the Central Dogma of gene expression for eukaryotes. Use the following terms in your diagram.

Protein    Translation      Entry into cytosol

DNA      Transcription    mRNA

RNA      Pre-mRNA      RNA processing

2.2) Why does DNA synthesis only proceed in the 5’ to 3’ direction?

1. Because DNA polymerase can only add nucleotides to the 3´ end of the polynucleotide strand.
2. Because the 3´ end of the polynucleotide molecule is more electronegative that the 5´ end.
3. Because that is the direction in which the two strands of DNA unzip.
4. Because that is the only direction that polymerase can be oriented.
5. Because the chromosomes are always aligned in the 5´ to the 3´ direction in the nucleus.

2.2) Two chains of DNA must run in _________ direction(s) and must be ________ if they are to bond with each other.

1. The same; uncomplementary.
2. Opposite; uncomplementary.
3. Parallel; uncomplementary.
4. Parallel; complementary.
5. Antiparallel; complementary.