The polypeptide consists of the following amino acids: valine - alanine - glycine - lysine - tryptophan - valine - serine - glutamic acid - determine the amino acid sequence using the genetic code.
Assuming that the question requires us to determine the base sequence using the genetic code;
We will use the RNA genetic code
The answer will be;
AUGGUAGCAGGAAAGUGGGUAUCAGAGUAA
The first and the last codons being Start and Stop codons respectively
Comments