107 800
Assignments Done
100%
Successfully Done
In November 2024
Physics help
Your physics assignments can be a real challenge, and the due date can be really close — feel free to use our assistance and get the desired result.
Physics
 Math help
Be sure that math assignments completed by our experts will be error-free and done according to your instructions specified in the submitted order form.
Math
 Programming help
Our experts will gladly share their knowledge and help you with programming projects. Keep up with the world’s newest programming trends.
Programming

Answer to Question #161593 in Molecular Biology for Virat

Question #161593

The polypeptide consists of the following amino acids: valine - alanine - glycine - lysine - tryptophan - valine - serine - glutamic acid - determine the amino acid sequence using the genetic code.


1
Expert's answer
2021-02-22T13:46:25-0500

Assuming that the question requires us to determine the base sequence using the genetic code;

We will use the RNA genetic code

The answer will be;

AUGGUAGCAGGAAAGUGGGUAUCAGAGUAA


The first and the last codons being Start and Stop codons respectively


Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Place free inquiry
Calculate the price
Learn more about our help with Assignments: Molecular Biology

Comments

No comments. Be the first!

Leave a comment

Related Questions

Our fields of expertise
10 years of AssignmentExpert
LATEST TUTORIALS
New on Blog
APPROVED BY CLIENTS
"assignmentexpert.com" is professional group of people in Math subjects! They did assignments in very high level of mathematical modelling in the best quality. Thanks a lot
Canada #339914 on Dec 2023