Answer to Question #161593 in Molecular Biology for Virat

Question #161593

The polypeptide consists of the following amino acids: valine - alanine - glycine - lysine - tryptophan - valine - serine - glutamic acid - determine the amino acid sequence using the genetic code.


1
Expert's answer
2021-02-22T13:46:25-0500

Assuming that the question requires us to determine the base sequence using the genetic code;

We will use the RNA genetic code

The answer will be;

AUGGUAGCAGGAAAGUGGGUAUCAGAGUAA


The first and the last codons being Start and Stop codons respectively


Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Comments

No comments. Be the first!

Leave a comment