Answer to Question #214522 in Molecular Biology for Moe

Molecular Biology

Question #214522

2.3) Which part of a ribosome accepts a tRNA molecule that is attached to a growing polypeptide chain?

A site
P site
E site
all because the growing polypeptide moves from one site to the other.

Expert's answer

P site

Learn more about our help with Assignments: Molecular Biology

Comments

No comments. Be the first!

Leave a comment

Related Questions

1. 2.3) What is a polyribosome?
2. 2.3) What are the roles of the P site, A site and E site on the large subunit of the ribosome?
3. 2.3) Discuss the functions of mRNA, rRNA and tRNA during protein synthesis.
4. 2.3) Give short explanations for the following terms: promoter; “upstream” end of a transcriptio
5. 2.3) Tabulate the similarities and differences between DNA polymerase and RNA polymerase.
6. 2.3) Tabulate four differences between DNA replication and RNA transcription.
7. 2.3) From this sense strand of DNA:5’ATGCCGGGGTGATCTACGTAGATTGCAAAAATGA3’ give the complementar