Answer to Question #108073 in Molecular Biology for Subhan

Molecular Biology

Question #108073

How many classes lipids are classified????
8 or 6 ???

Expert's answer

8 classes: fatty acyls, glycerolipids, glycerophospholipids, sphingolipids, sterol lipids, prenol lipids, saccharolipids, and polyketides

Learn more about our help with Assignments: Molecular Biology

Comments

No comments. Be the first!

Leave a comment

Related Questions

1. ATGGGCGTTACAGGAATATTGCAGTTACCTCGTGATCGATTCAAGAGGACATCATTCTTT CTTTGGGTAATTATCCTTTTCCAAAGAACATTTTCCAT
2. What Tm value (to 1 decimal place) would you use for the forward primer when calculating the anneali
3. Which of the following is true of the lac operon in E. coli? 1. The operon is only switched on in t
4. The following are associated with cloning, except________. 1. restriction endonucleases 2. vector
5. You are working in a molecular biology lab and, unknown to you, your lab partner left the foreign
6. If glucose is absent, but so is lactose, the lac operon will be ________. 1. activated 2. represse
7. Which statement about nucleic acids is not correct? 1. They are macromolecules. 2. They are organi