you sequence the DNA of the tryptophanase operon promoter and obtain the DNA sequence shown below. Underline and name the two critical regions needed for binding the sigma 70 factor -40 AGAATAGACAAAAACTCTGAGTGTAATAATGCCTCGTAGATCG +6
"assignmentexpert.com" is professional group of people in Math subjects! They did assignments in very high level of mathematical modelling in the best quality. Thanks a lot
Comments