you sequence the DNA of the tryptophanase operon promoter and obtain the DNA sequence shown below. Underline and name the two critical regions needed for binding the sigma 70 factor -40 AGAATAGACAAAAACTCTGAGTGTAATAATGCCTCGTAGATCG +6
Numbers and figures are an essential part of our world, necessary for almost everything we do every day. As important…
APPROVED BY CLIENTS
Finding a professional expert in "partial differential equations" in the advanced level is difficult.
You can find this expert in "Assignmentexpert.com" with confidence.
Exceptional experts! I appreciate your help. God bless you!
Comments
Leave a comment