you sequence the DNA of the tryptophanase operon promoter and obtain the DNA sequence shown below. Underline and name the two critical regions needed for binding the sigma 70 factor -40 AGAATAGACAAAAACTCTGAGTGTAATAATGCCTCGTAGATCG +6
The expert did excellent work as usual and was extremely helpful for me.
"Assignmentexpert.com" has experienced experts and professional in the market. Thanks.
Comments