Bioinformatics Answers

Questions answered by Experts: 107

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Search

Two proteins have 20 % sequence identity. Is this likely to be significant? What other simple piece of information do you need to answer this question properly?


(b) For the given DNA coding sequence, generate an RNA sequence.


DNA Sequence: CGATGCCTCGCTAGAGGCTCGAAAGCTCTTTCGGAGATAATCG


RNA Sequence:




String Parenthesis Representation:


Arch Diagram:


It is believed that protein sequence evolves and changes faster than protein structure. What could be an evolutionary explanation for this?
Name an application where you would use a method like BLAST and not a Needleman-Wunsch alignment. Name an application where you would use a slow method like Needleman and Wunsch, rather than a BLAST-like method. (2)
Why is it necessary to know the location of a gene and how?
a. In the agarose gel electrophoresis practical class, you are instructed to prepare a 750 ml of 1X TAE buffer from 25X TAE stock buffer. Subsequently, you are requested to prepare 35 ml of 0.75% (w/v) agarose gel using 1X TAE buffer that you prepared . Show your calculation and describe how you prepare the agarose gel
Without a bioinformatics tool, how can you calculate the molecular weight of protein?
it is noticed that major sequence alignments differ in approach computational complexity and accuracy. Do you agree with this? Explain it with examples

If you get a particular protein named ‘Keratin’. How will you retrieve its (a) Nucleic acid sequence (b) Protein sequence (c) Carbohydrate binding site, if present, (d) Protein chains (e) Amino acid frequency etc.? Describe in detail?


Identify 5 environmental factors that may influence communication
LATEST TUTORIALS
APPROVED BY CLIENTS