Learn more about our help with Assignments: Bioinformatics
Search & Filtering
Bioinformatics
Two proteins have 20 % sequence identity. Is this likely to be significant? What other simple piece of information do you need to answer this question properly?
Bioinformatics
(b) For the given DNA coding sequence, generate an RNA sequence.
DNA Sequence: CGATGCCTCGCTAGAGGCTCGAAAGCTCTTTCGGAGATAATCG
RNA Sequence:
String Parenthesis Representation:
Arch Diagram:
Bioinformatics
It is believed that protein sequence evolves and changes faster than protein structure. What could be an evolutionary explanation for this?
Bioinformatics
Name an application where you would use a method like BLAST and not a Needleman-Wunsch alignment. Name an application where you would use a slow method like Needleman and Wunsch, rather than a BLAST-like method. (2)
Bioinformatics
Why is it necessary to know the location of a gene and how?
Bioinformatics
a. In the agarose gel electrophoresis practical class, you are instructed to prepare a 750 ml of 1X TAE buffer from 25X TAE stock buffer. Subsequently, you are requested to prepare 35 ml of 0.75% (w/v) agarose gel using 1X TAE buffer that you prepared . Show your calculation and describe how you prepare the agarose gel
Bioinformatics
Without a bioinformatics tool, how can you calculate the molecular weight of protein?
Bioinformatics
it is noticed that major sequence alignments differ in approach computational complexity and accuracy. Do you agree with this? Explain it with examples
Bioinformatics
If you get a particular protein named ‘Keratin’. How will you retrieve its (a) Nucleic acid sequence (b) Protein sequence (c) Carbohydrate binding site, if present, (d) Protein chains (e) Amino acid frequency etc.? Describe in detail?
Bioinformatics
Identify 5 environmental factors that may influence communication
