Search & Filtering
given a cylindrical piggy bank with radius g and height y, return the bank's volume
Exercise 3: Practice to manipulate data in arrays Write a C program to create an integer array called Motion of size 5. Ask the user to enter values to the array from the keyboard. Rotate the values of the array by one position in the forward direction and display the values.
Ex: number in index 4 should move to index 3, Number in index 3 should move to index2, number index 0 should move to index 4.
Initial values 10 6 8 2 9
After rotating 6 8 2 9 10
Exercise 1: Practice to store and print data in an array
a) Write a C program that reads marks of 10 students in to a single subscripted array.
b) Above marks should be between 0 to 20. Modify the above program to add marks to the array only if the input mark is between the given range.
c) Display the values stored in the array.
Write a program to multiply every element of the linked list with 10
Write a program to print the total number of occurrences of a given item in the linked list
What is the java program for this?
Passenger fare is classified according to the type of passenger. Senior Citizen enjoys 20%discount from the regular fare, Students get 10% discount. Regular passengers who do not qualified as neither Senior Citizen nor a Student should pay the regular fare of 150.
Write an algorithm that will accept details of five (5) passengers, including its name and
passenger type and will compute for the corresponding fare of each passenger. Display
the name and type of passenger, as well as the computer fare.
Passenger fare is classified according to the type of passenger. Senior Citizen enjoys 20%
discount from the regular fare, Students get 10% discount. Regular passengers who do
not qualified as neither Senior Citizen nor a Student should pay the regular fare of 150.
Write an algorithm that will accept details of five (5) passengers, including its name and
passenger type and will compute for the corresponding fare of each passenger. Display
the name and type of passenger, as well as the computer fare.
nucleotides="ATGC"
nulength= len(nucleotides)
nucleostring=""
noofbase=0
inputbase= int(input("Enter the number of base: "))
while noofbase < inputbase:
rand=int(time.time_ns())
randomno=rand%nulength
nucleostring+=nucleotides[randomno]
noofbase+=1
print(nucleostring)
print("Forward: ")
print("DNA Seq")
if len(nucleostring)%3 == 0:
for i in range(0, len(nucleostring),3):
c= nucleostring[i: i+3]
print(c)
but i need output in horizontal line
output Enter the number of base: 6
TACGCTTCTCGTGCCTCCTCCGCTGCGATCCAACCA
Forward:
DNA Seq
TAC
GCT
We have a list
Input = [5,'Unnamed: 1','Unnamed: 2','Unnamed: 3', 6, 'Unnamed: 5','Unnamed: 6']
want to convert it into: Output= [5,5,5,5,6,6,6]
