Search & Filtering
Is there any ways to reduce flood using biomimicry
Is SNV (Single Nucleotide Variants) a type of SV (Structural Variation) or not?
how will you identify the domain of an unknown protein sequence? with an appropriate example, describe in detail the bioinformatics tool, web server, database, and procedure (step by step) that you would use.
If you want to study a particular protein named ‘Keratin’. How will you retrieve its nucleic acid sequence, protein sequence, carbohydrate binding site (in present), protein chains, and amino acid frequency? With an appropriate example, describe in detail the bioinformatics tool, web server, database, and procedure (step by step) that you would use.
Which macromolecule is made of glycerol and fatty acids?
The frequent words with mismatches problem
One way to solve the Frequent Words with Mismatches problem is to generate all 4k k-mers Pattern, compute ApproximatePatternCount(Text, Pattern, d) for each k-mer Pattern, and then find k-mers with the maximum number of approximate occurrences. This is an inefficient approach in practice, since many of the 4k k-mers should not be considered because neither they nor their mutated versions (with up to d mismatches) appear in Text.
Genome= GCAAAATGGAGCAGGATCAGCAAAATGGAAAATAAATGGAGGATCAAAATAAATGGAGGAGGAAAATGGAGGAAAATAAATGGATCAGGAAAATGCAGCAGGATCATCATCAGGAGCAGGATCAAAATTCAGGAGCAGGAGGATCAGCATCAGGAGGATCAGCAGGAAAATGCAGGAGGAGGAGGAAAATTCAAAATGGAGGAGGAGGAGCATCAGCAGCATCAGGAGGAGGATCAGCAGCAGGAGGAGGAGGAGGAAAATGGAGGAGGAGCAGGAGGAGCATCAGGAGGATCAGGAGCATCAGCAAAATTCAAAATGGAGGAAAATGCAGGAAAATGGAGCAGGAAAATAAATTCATCAAAATGCAGGAGGA
k= 6
d= 2
